Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
NP_001139235.1
- Ensembl ID:
- ENSDARG00000037195
- Description:
- thyrotropin receptor [Source:RefSeq peptide;Acc:NP_001139235]
- Human Orthologue:
- TSHR
- Human Description:
- thyroid stimulating hormone receptor [Source:HGNC Symbol;Acc:12373]
- Mouse Orthologue:
- Tshr
- Mouse Description:
- thyroid stimulating hormone receptor Gene [Source:MGI Symbol;Acc:MGI:98849]
Alleles
There are 3 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa36962 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa5947 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa12444 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa36962
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000054086 | Nonsense | 277 | 757 | 9 | 10 |
- Genomic Location (Zv9):
- Chromosome 20 (position 6124722)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 6030086 GRCz11 20 6073576 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGCCACCAATCAAGACTTTTAGACACCTAGTTACAGCAGACTTGACCTA[C/A]CCCAGCCACTGCTGTGCGTTCAAGAATTTGAAGAAAAAACGGGGGTGTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa5947
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000054086 | Essential Splice Site | 292 | 757 | 9 | 10 |
- Genomic Location (Zv9):
- Chromosome 20 (position 6124767)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 6030131 GRCz11 20 6073621 - KASP Assay ID:
- 554-3867.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACCTACCCCAGCCACTGCTGTGCGTTCAAGAATTTGAAGAAAAAACGGGG[G/A]TGTGTGGCTACAGTCTRAATTATTKTATGTTAGATCAGTAAATATATGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12444
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000054086 | Nonsense | 304 | 757 | 10 | 10 |
- Genomic Location (Zv9):
- Chromosome 20 (position 6129622)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 6034986 GRCz11 20 6078470 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTTYGCTTCTGGCAGGTTCATAGAGGAAATCATTTGTAACCTGACTGCY[C/T]GAAAGAATCAAGTTCAAAAGAGATCYGTGAGAGCTTTCACAATTCMCGGA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Graves' disease: A genome-wide association study identifies two new risk loci for Graves' disease. (View Study)
- Hair morphology: Common variants in the trichohyalin gene are associated with straight hair in Europeans. (View Study)
- Optic disc size (rim): Genome-wide association identifies ATOH7 as a major gene determining human optic disc size. (View Study)
- Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
