Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rpa2
- Ensembl ID:
- ENSDARG00000037188
- ZFIN ID:
- ZDB-GENE-010131-3
- Description:
- replication protein A 32 kDa subunit [Source:RefSeq peptide;Acc:NP_571786]
- Human Orthologues:
- RPA2, RPA4
- Human Descriptions:
- replication protein A2, 32kDa [Source:HGNC Symbol;Acc:10290]
- replication protein A4, 30kDa [Source:HGNC Symbol;Acc:30305]
- Mouse Orthologue:
- Rpa2
- Mouse Description:
- replication protein A2 Gene [Source:MGI Symbol;Acc:MGI:1339939]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa28573 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa28573
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000054078 | Essential Splice Site | 243 | 271 | 8 | 9 |
- Genomic Location (Zv9):
- Chromosome 16 (position 5696639)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 4922622 GRCz11 16 4751911 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCATGAACTCAAGCAGAAGCTCAACAGCATGAGCGCCAACGTCATCAGG[T/C]ACAAACTTCTCCTTCCGAGATAAGCCTCTGTTAAGAACGACCTTCTATAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
