zgc:101084

Ensembl ID:
ENSDARG00000037182
ZFIN ID:
ZDB-GENE-040801-86
Description:
surfeit locus protein 2 [Source:RefSeq peptide;Acc:NP_001003567]
Human Orthologue:
SURF2
Human Description:
surfeit 2 [Source:HGNC Symbol;Acc:11475]
Mouse Orthologue:
Surf2
Mouse Description:
surfeit gene 2 Gene [Source:MGI Symbol;Acc:MGI:98444]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40345 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40345
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054070 Nonsense 217 228 5 5
Genomic Location (Zv9):
Chromosome 5 (position 1529040)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 1153390
GRCz11 5 1207805
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTCAGACTGATGAAGATGAAGAGGAAATGGAAGTAGAAAACCAGGAG[C/T]AGAAACGCAGGAAGGTTGGAGAATCACATTTATTTTATTTATAAATCTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Prothrombin time: Genetic associations for activated partial thromboplastin time and prothrombin time, their gene expression profiles, and risk of coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link