zic2b

Ensembl ID:
ENSDARG00000037178
ZFIN ID:
ZDB-GENE-030219-92
Description:
zic family member 2b [Source:RefSeq peptide;Acc:NP_001001820]
Human Orthologue:
ZIC2
Human Description:
Zic family member 2 (odd-paired homolog, Drosophila) [Source:HGNC Symbol;Acc:12873]
Mouse Orthologue:
Zic2
Mouse Description:
zinc finger protein of the cerebellum 2 Gene [Source:MGI Symbol;Acc:MGI:106679]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32696 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32696
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054066 Nonsense 250 427 1 3

The following transcripts of ENSDARG00000037178 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 28804300)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 29055129
GRCz11 1 29859060
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACTGGTCACGCATGTGTCCACTGAGCACGTTGGCGGGCCAGAACAGTG[T/A]AACCACATCTGCTTTTGGGAAGAATGTCCACGGGAGAGCAAACCATTCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link