
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:66359
- Ensembl ID:
- ENSDARG00000037177
- ZFIN ID:
- ZDB-GENE-040426-1619
- Description:
- Novel protein (Zgc:66359) [Source:UniProtKB/TrEMBL;Acc:B0S5D8]
- Human Orthologues:
- AC002365.1, AC003980.1, AC006062.1, AC006999.1, AC007379.1, AC008162.1, AC008573.1, AC008794.1, AC009021.1, AC010133.1, AC011503.2, AC012596.1, AC016595.1, AC022409.1, AC022486.1, AC023481.1, AC067941.1, AC092485.1, AC097714.1, AC116351.3, AC145210.1, AL121899.1, AL138690.1, AL159986.1, AL357512.1, AL591242.1, ZC3H13
- Human Description:
- zinc finger CCCH-type containing 13 [Source:HGNC Symbol;Acc:20368]
- Mouse Orthologues:
- Gm10563, Zc3h13
- Mouse Descriptions:
- predicted gene 10563 Gene [Source:MGI Symbol;Acc:MGI:3642630]
- zinc finger CCCH type containing 13 Gene [Source:MGI Symbol;Acc:MGI:1914552]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa31208 | Essential Splice Site | Available for shipment | Available now |
sa45075 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa19512 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa31208
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000054064 | Essential Splice Site | None | 1759 | 1 | 21 |
ENSDART00000110816 | Essential Splice Site | None | 244 | 1 | 11 |
- Genomic Location (Zv9):
- Chromosome 1 (position 28712095)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 28962924 GRCz11 1 29766855 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATCCCCAATAGTCTGTGAAACTGGACTTGACGCATCAATCATATTCGGG[T/C]AAATTAGAATTTGTTTATGGAGCCATTAAAGGGTCCGTTTTAGCTGTATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45075
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000054064 | Essential Splice Site | None | 1759 | None | 21 |
ENSDART00000110816 | Essential Splice Site | None | 244 | None | 11 |
- Genomic Location (Zv9):
- Chromosome 1 (position 28714593)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 28965422 GRCz11 1 29769353 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GACTGTAACACAGCTTTGTAATTGAAGTGATTTCTATTTATTTTTAATTC[A/G]GCCCTGCAGAATGTCCAAGATCAGGCGGAAGGTTACAGTGGAGAATTCGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19512
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000054064 | Nonsense | 1542 | 1759 | 18 | 21 |
ENSDART00000110816 | None | 244 | None | 11 |
- Genomic Location (Zv9):
- Chromosome 1 (position 28737817)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 28988646 GRCz11 1 29792577 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTTTTTCTCTGTTCTTTCAGAAGAGGAAGATGGAAAAGCAGATGATGCA[C/T]AGTCTGTTGTGTCAGGTGGTGAGGAGTATGAGCCAATCAGTGACGATGAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: