zgc:66359

Ensembl ID:
ENSDARG00000037177
ZFIN ID:
ZDB-GENE-040426-1619
Description:
Novel protein (Zgc:66359) [Source:UniProtKB/TrEMBL;Acc:B0S5D8]
Human Orthologues:
AC002365.1, AC003980.1, AC006062.1, AC006999.1, AC007379.1, AC008162.1, AC008573.1, AC008794.1, AC009021.1, AC010133.1, AC011503.2, AC012596.1, AC016595.1, AC022409.1, AC022486.1, AC023481.1, AC067941.1, AC092485.1, AC097714.1, AC116351.3, AC145210.1, AL121899.1, AL138690.1, AL159986.1, AL357512.1, AL591242.1, ZC3H13
Human Description:
zinc finger CCCH-type containing 13 [Source:HGNC Symbol;Acc:20368]
Mouse Orthologues:
Gm10563, Zc3h13
Mouse Descriptions:
predicted gene 10563 Gene [Source:MGI Symbol;Acc:MGI:3642630]
zinc finger CCCH type containing 13 Gene [Source:MGI Symbol;Acc:MGI:1914552]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31208 Essential Splice Site Available for shipment Available now
sa45075 Essential Splice Site Mutation detected in F1 DNA During 2018
sa19512 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31208
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054064 Essential Splice Site None 1759 1 21
ENSDART00000110816 Essential Splice Site None 244 1 11
Genomic Location (Zv9):
Chromosome 1 (position 28712095)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28962924
GRCz11 1 29766855
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCCCCAATAGTCTGTGAAACTGGACTTGACGCATCAATCATATTCGGG[T/C]AAATTAGAATTTGTTTATGGAGCCATTAAAGGGTCCGTTTTAGCTGTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45075
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054064 Essential Splice Site None 1759 None 21
ENSDART00000110816 Essential Splice Site None 244 None 11
Genomic Location (Zv9):
Chromosome 1 (position 28714593)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28965422
GRCz11 1 29769353
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTGTAACACAGCTTTGTAATTGAAGTGATTTCTATTTATTTTTAATTC[A/G]GCCCTGCAGAATGTCCAAGATCAGGCGGAAGGTTACAGTGGAGAATTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19512
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054064 Nonsense 1542 1759 18 21
ENSDART00000110816   None 244 None 11
Genomic Location (Zv9):
Chromosome 1 (position 28737817)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28988646
GRCz11 1 29792577
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTCTCTGTTCTTTCAGAAGAGGAAGATGGAAAAGCAGATGATGCA[C/T]AGTCTGTTGTGTCAGGTGGTGAGGAGTATGAGCCAATCAGTGACGATGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link