zgc:113355

Ensembl ID:
ENSDARG00000037174
ZFIN ID:
ZDB-GENE-050410-11
Description:
hypothetical protein LOC548344 [Source:RefSeq peptide;Acc:NP_001017548]
Human Orthologue:
NEK11
Human Description:
NIMA (never in mitosis gene a)- related kinase 11 [Source:HGNC Symbol;Acc:18593]
Mouse Orthologue:
Nek11
Mouse Description:
NIMA (never in mitosis gene a)-related expressed kinase 11 Gene [Source:MGI Symbol;Acc:MGI:2442276]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22491 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22491
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054062 Nonsense 465 488 4 4
Genomic Location (Zv9):
Chromosome 14 (position 29446979)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 28120899
GRCz11 14 28426857
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAGCACTTTTTGAATGGCCTCACACCAGAAGACCTGCAGCCACAGTTT[C/T]AGCACATGATCGGTACTGACCATCTGGAGACCTGCTATCTCATATTCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link