
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:113355
- Ensembl ID:
- ENSDARG00000037174
- ZFIN ID:
- ZDB-GENE-050410-11
- Description:
- hypothetical protein LOC548344 [Source:RefSeq peptide;Acc:NP_001017548]
- Human Orthologue:
- NEK11
- Human Description:
- NIMA (never in mitosis gene a)- related kinase 11 [Source:HGNC Symbol;Acc:18593]
- Mouse Orthologue:
- Nek11
- Mouse Description:
- NIMA (never in mitosis gene a)-related expressed kinase 11 Gene [Source:MGI Symbol;Acc:MGI:2442276]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa22491 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa22491
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000054062 | Nonsense | 465 | 488 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 14 (position 29446979)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 28120899 GRCz11 14 28426857 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGAGCACTTTTTGAATGGCCTCACACCAGAAGACCTGCAGCCACAGTTT[C/T]AGCACATGATCGGTACTGACCATCTGGAGACCTGCTATCTCATATTCAAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: