slc8a4b

Ensembl ID:
ENSDARG00000037145
ZFIN ID:
ZDB-GENE-050809-103
Description:
solute carrier family 8 (sodium/calcium exchanger), member 4b [Source:RefSeq peptide;Acc:NP_0011167
Human Orthologue:
SLC8A1
Human Description:
solute carrier family 8 (sodium/calcium exchanger), member 1 [Source:HGNC Symbol;Acc:11068]
Mouse Orthologue:
Slc8a1
Mouse Description:
solute carrier family 8 (sodium/calcium exchanger), member 1 Gene [Source:MGI Symbol;Acc:MGI:107956]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34209 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34209
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054007 Nonsense 528 925 3 8
Genomic Location (Zv9):
Chromosome 7 (position 60675662)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 59894627
GRCz11 7 60199864
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCCTAGTGCTGCCCTTGGTGAGGCTCACACGGCAACAGTGACAATCTA[T/A]GATGATGACCATGCCGGAATTTTCACATTTGAGAGTGAATCAATGCGAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link