
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:110847
- Ensembl ID:
- ENSDARG00000037121
- ZFIN ID:
- ZDB-GENE-050327-6
- Description:
- S-adenosylmethionine synthase isoform type-2 [Source:RefSeq peptide;Acc:NP_001014318]
- Human Orthologue:
- MAT2A
- Human Description:
- methionine adenosyltransferase II, alpha [Source:HGNC Symbol;Acc:6904]
- Mouse Orthologue:
- Mat2a
- Mouse Description:
- methionine adenosyltransferase II, alpha Gene [Source:MGI Symbol;Acc:MGI:2443731]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38530 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa38530
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000053963 | Essential Splice Site | 136 | 363 | 4 | 8 |
- Genomic Location (Zv9):
- Chromosome 5 (position 72067577)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 68435106 GRCz11 5 69207475 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGGCGTTCATTTAGAGCGAGACGAGCAGGACGTTGGGGCTGGTGATCAG[G/A]TACGTTGGTGGTTCATTCCACTGTGGCGGCCACTGATAAATAAGGGACTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: