zgc:56306

Ensembl ID:
ENSDARG00000037099
ZFIN ID:
ZDB-GENE-040426-975
Description:
insulin receptor substrate 2 [Source:RefSeq peptide;Acc:NP_956609]
Human Orthologues:
IRS1, IRS4
Human Descriptions:
insulin receptor substrate 1 [Source:HGNC Symbol;Acc:6125]
insulin receptor substrate 4 [Source:HGNC Symbol;Acc:6128]
Mouse Orthologues:
Irs1, Irs3, Irs4
Mouse Descriptions:
insulin receptor substrate 1 Gene [Source:MGI Symbol;Acc:MGI:99454]
insulin receptor substrate 3 Gene [Source:MGI Symbol;Acc:MGI:1194882]
insulin receptor substrate 4 Gene [Source:MGI Symbol;Acc:MGI:1338009]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18282 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18282
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053924 Nonsense 357 1032 1 2
Genomic Location (Zv9):
Chromosome 1 (position 28143406)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28408833
GRCz11 1 29212764
KASP Assay ID:
2259-0667.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCCCAATGACTGTTGGCCGGMACCACATGAGTAGATCTAATACWGTTT[C/A]AGTAGGCTGTCGGACATCAGAACCATCACTACTWAATCACAGCAGGTCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link