zgc:152968

Ensembl ID:
ENSDARG00000037002
ZFIN ID:
ZDB-GENE-061013-448
Description:
hypothetical protein LOC564848 [Source:RefSeq peptide;Acc:NP_001071033]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30801 Nonsense Mutation detected in F1 DNA During 2018
sa897 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa30801
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053780   None 506 None 12
ENSDART00000075160 Nonsense 1045 1213 13 17
ENSDART00000130013 Nonsense 1052 1220 15 19
ENSDART00000139636 Nonsense 1083 1251 13 17

The following transcripts of ENSDARG00000037002 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 35701878)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 35261736
GRCz11 1 35993763
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCAGTTAGCCTTCAGGGCTTTGTGAGCAGTCTTCATCAGTCTGCGGTG[G/T]GAAAAACATGTCCAGGAATCTATGCCATTGACACACAAACAGTAAGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa897
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053780   None 506 None 12
ENSDART00000075160 Essential Splice Site 1184 1213 16 17
ENSDART00000130013 Essential Splice Site 1191 1220 18 19
ENSDART00000139636 Essential Splice Site 1222 1251 16 17

The following transcripts of ENSDARG00000037002 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 35704191)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 35264049
GRCz11 1 35996076
KASP Assay ID:
554-0804.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAACAGTCTGACTGCAGACTACCTCCGGAGAATTATACAAGAGAGTGG[T/C]ATGTTGGCCTACTRCACACATTTGTAAACAATGACCATGAGAAAGCCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link