si:dkey-32e23.6

Ensembl ID:
ENSDARG00000036999
ZFIN ID:
ZDB-GENE-081104-407
Description:
Novel protein similar to vertebrate patched domain containing 2 (Ptchd2) [Source:UniProtKB/TrEMBL;Ac
Human Orthologue:
PTCHD2
Human Description:
patched domain containing 2 [Source:HGNC Symbol;Acc:29251]
Mouse Orthologue:
Ptchd2
Mouse Description:
patched domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2444403]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41303 Nonsense Mutation detected in F1 DNA During 2018
sa30908 Nonsense Mutation detected in F1 DNA During 2018
sa16571 Splice Site, Nonsense Available for shipment Available now
sa9894 Essential Splice Site Available for shipment Available now
sa34506 Essential Splice Site Mutation detected in F1 DNA During 2018
sa21392 Essential Splice Site Available for shipment Available now
sa27283 Essential Splice Site Mutation detected in F1 DNA During 2018
sa34507 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41303
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053768 Nonsense 306 1326 1 22
ENSDART00000127709 Nonsense 276 1300 2 24
ENSDART00000131312 Nonsense 245 518 1 6
ENSDART00000053768 Nonsense 306 1326 1 22
ENSDART00000127709 Nonsense 276 1300 2 24
ENSDART00000131312 Nonsense 245 518 1 6
Genomic Location (Zv9):
Chromosome 8 (position 53354363)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51096888
GRCz11 8 51085910
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGTCCTGTCCTACCTCTTTCCCAGTGAGCGAGCAGGGAAGATCTACTA[T/A]GATGGAATGGGGCCTGATCTTGCTGATATACATGGTGAGTTGCGAGGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30908
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053768 Nonsense 306 1326 1 22
ENSDART00000127709 Nonsense 276 1300 2 24
ENSDART00000131312 Nonsense 245 518 1 6
ENSDART00000053768 Nonsense 306 1326 1 22
ENSDART00000127709 Nonsense 276 1300 2 24
ENSDART00000131312 Nonsense 245 518 1 6
Genomic Location (Zv9):
Chromosome 8 (position 53354363)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51096888
GRCz11 8 51085910
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGTCCTGTCCTACCTCTTTCCCAGTGAGCGAGCAGGGAAGATCTACTA[T/A]GATGGAATGGGGCCTGATCTTGCTGATATACATGGTGAGTTGCGAGGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16571
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053768   None 1326 None 22
ENSDART00000127709 Splice Site, Nonsense 592 1300 9 24
ENSDART00000131312   None 518 None 6
Genomic Location (Zv9):
Chromosome 8 (position 53370074)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51112599
GRCz11 8 51101621
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGGTAGGGGAGAGTGGAGATGGYTGCAACAAGACTTAWTCCTCTATT[T/A]AGGCATGAGCTAGAGTSMTGATATTTTTACTACATATTCTCAGTTAGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9894
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053768 Essential Splice Site 631 1326 7 22
ENSDART00000127709 Essential Splice Site 606 1300 10 24
ENSDART00000131312   None 518 None 6
Genomic Location (Zv9):
Chromosome 8 (position 53371516)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51114041
GRCz11 8 51103063
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCTCAGATGATGATGAYGTGGCTCTGATAACKGTCGAAATGGAACCAG[G/A]TACACTGTATAAAACATTGCACAACAAATTRTGCAGGAGTGTTTTTATAN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34506
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053768 Essential Splice Site 830 1326 11 22
ENSDART00000127709 Essential Splice Site 805 1300 14 24
ENSDART00000131312   None 518 None 6
Genomic Location (Zv9):
Chromosome 8 (position 53390410)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51132834
GRCz11 8 51121856
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCCTGGCAGGCTTCATCGGCTGCACACGGAGACGTGCCATCCTTTCAG[G/A]TCTGTGCTAACACACTCATTTACACACATTCATTAACACACGTGACACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21392
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053768 Essential Splice Site 887 1326 12 22
ENSDART00000127709 Essential Splice Site 862 1300 15 24
ENSDART00000131312   None 518 None 6
Genomic Location (Zv9):
Chromosome 8 (position 53395421)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51137815
GRCz11 8 51126837
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGCAGAGTTCGAGTTTTACGTGGCTTCGGTGGAGCAGCAGCGCAGCAG[G/A]CGAGTTTGTGTGTGTGTGTGTGTGTGCTGAAGACTGATGAGCCGTGACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27283
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053768   None 1326 None 22
ENSDART00000127709 Essential Splice Site 906 1300 17 24
ENSDART00000131312   None 518 None 6
Genomic Location (Zv9):
Chromosome 8 (position 53401820)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51144115
GRCz11 8 51133137
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTTTTTTTTTCCCTTCTCTGGTAAGGTTATTCTCTTGTATATGTGCTC[A/G]GCTCCTGCCCAGGTGAAGATCTCCAGGACATCAGGCTTTAACCCCTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34507
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053768 Essential Splice Site 990 1326 16 22
ENSDART00000127709 Essential Splice Site 965 1300 18 24
ENSDART00000131312   None 518 None 6
Genomic Location (Zv9):
Chromosome 8 (position 53403504)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51145790
GRCz11 8 51134812
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTATGAATTATTAATGCACTGATTTGTTGACGTTCCTCCTCCTCAAA[G/T]GGCAATGTGATCTATGACCAAGACTTTGATGTTTTTAATGAGATCGGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link