si:dkey-202m22.4

Ensembl ID:
ENSDARG00000036956
ZFIN ID:
ZDB-GENE-091116-9
Description:
Asxl1 protein [Source:UniProtKB/TrEMBL;Acc:Q6P6X8]
Human Orthologue:
ASXL1
Human Description:
additional sex combs like 1 (Drosophila) [Source:HGNC Symbol;Acc:18318]
Mouse Orthologue:
Asxl1
Mouse Description:
additional sex combs like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2684063]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45806 Nonsense Mutation detected in F1 DNA During 2018
sa32451 Nonsense Available for shipment Available now
sa45807 Nonsense Mutation detected in F1 DNA During 2018
sa44017 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45806
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042944 Nonsense 246 1632 7 11
ENSDART00000134141 Nonsense 233 1619 8 12

The following transcripts of ENSDARG00000036956 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 30985967)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30820857
GRCz11 23 30747388
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCTCTCATCAACACACGGACCTTTGCTGCTTTTCCTTCTCACTCCCAG[C/T]AGCAACTACTCCAGCTTTTACCAGAGGTGGACAGACAGGTATATGTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32451
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042944 Nonsense 934 1632 11 11
ENSDART00000134141 Nonsense 921 1619 12 12

The following transcripts of ENSDARG00000036956 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 30988450)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30823340
GRCz11 23 30749871
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTGAGCTTCACCCAGGGACAACTGGAGTTATCCAGCATGGCTCAGACT[T/A]GAAATTACCCAAAGAGACTCTTGTTACAGCCAGAAATGGATGGGTAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45807
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042944 Nonsense 1268 1632 11 11
ENSDART00000134141 Nonsense 1255 1619 12 12

The following transcripts of ENSDARG00000036956 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 30989451)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30824341
GRCz11 23 30750872
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCTACGGACACTGTTAGTTCTGACTTCCAACACAAAACCCCACCTGCT[C/T]GAGTATCTCCTGGACCTGGTCGGAACTTTGGTTCTTCCCCGCCAGGTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44017
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042944 Nonsense 1625 1632 11 11
ENSDART00000134141 Nonsense 1612 1619 12 12

The following transcripts of ENSDARG00000036956 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 30990524)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30825414
GRCz11 23 30751945
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGTGGCGCTTTCTGCCATGATGATTGCATCGGCCCTTCGAAACTGTG[T/A]GTGTCATGTCTGGTTGTCAGATAGTTTGTTGCAGCTCCTTTAAAACTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link