
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rnf139
- Ensembl ID:
- ENSDARG00000036929
- ZFIN IDs:
- ZDB-GENE-080401-4, ZDB-GENE-080401-4, ZDB-GENE-080401-4
- Description:
- RING finger protein 139 [Source:RefSeq peptide;Acc:NP_001116520]
- Human Orthologue:
- RNF139
- Human Description:
- ring finger protein 139 [Source:HGNC Symbol;Acc:17023]
- Mouse Orthologue:
- Rnf139
- Mouse Description:
- ring finger protein 139 Gene [Source:MGI Symbol;Acc:MGI:1923091]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23398 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa23398
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000053622 | Nonsense | 32 | 664 | 1 | 3 |
ENSDART00000122054 | Nonsense | 32 | 664 | 1 | 2 |
ENSDART00000129713 | Nonsense | 32 | 664 | 1 | 4 |
- Genomic Location (Zv9):
- Chromosome 19 (position 181919)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 170789 GRCz11 19 170879 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTGGATGTGGTTCTGCGGGTCCCGAGCATCTTTATAATCGACGCCATAT[T/A]GAACTCGTACTCTGATCCCGGTACCGGATGGAGCGGCGCCGCCGGGAGAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: