A1L2D9_DANRE

Ensembl ID:
ENSDARG00000036900
Description:
LOC557557 protein [Source:UniProtKB/TrEMBL;Acc:A1L2D9]
Human Orthologue:
CFI
Human Description:
complement factor I [Source:HGNC Symbol;Acc:5394]
Mouse Orthologue:
Cfi
Mouse Description:
complement component factor i Gene [Source:MGI Symbol;Acc:MGI:105937]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30453 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30453
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053577 Essential Splice Site 135 619 1 14
ENSDART00000129111   135 616 1 12
ENSDART00000129892 Essential Splice Site 230 385 2 9
Genomic Location (Zv9):
Chromosome Zv9_NA918 (position 19312)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150402.1 19312
GRCz11 23 45277378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAACAAACCCACTTTCTCACACTTCAGCAGAACCTGCAAAAGTAAGAC[G/A]TCAACCTTTAAAATACACATGACACCAAAGCTAATCATGTTGATGTTGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link