zgc:101853

Ensembl ID:
ENSDARG00000036894
ZFIN IDs:
ZDB-GENE-041212-13, ZDB-GENE-041212-13
Description:
hypothetical protein LOC494049 [Source:RefSeq peptide;Acc:NP_001008592]
Human Orthologue:
AIMP1
Human Description:
aminoacyl tRNA synthetase complex-interacting multifunctional protein 1 [Source:HGNC Symbol;Acc:1064
Mouse Orthologue:
Aimp1
Mouse Description:
aminoacyl tRNA synthetase complex-interacting multifunctional protein 1 Gene [Source:MGI Symbol;Acc:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30008 Nonsense Mutation detected in F1 DNA During 2018
sa37799 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30008
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053569 Nonsense 33 282 3 7
ENSDART00000129872 Nonsense 33 282 4 8
Genomic Location (Zv9):
Chromosome 23 (position 44869210)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45643738
GRCz11 23 45405010
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGCAGGCGTCAGTGAGGGAGGAGAAGAAACTGCTGGTAGAAAACGCC[A/T]AACTGAAGAAAGACATCGACGACCTGAAGAACCTGCTGCAGGACACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37799
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053569 Essential Splice Site 54 282 3 7
ENSDART00000129872 Essential Splice Site 54 282 4 8
Genomic Location (Zv9):
Chromosome 23 (position 44869275)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45643673
GRCz11 23 45404945
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGACGACCTGAAGAACCTGCTGCAGGACACACAGAAGAGGAAAGCAGG[T/C]ACTACACACACACACACACACACACACACACACACACACACACACACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link