
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:101853
- Ensembl ID:
- ENSDARG00000036894
- ZFIN IDs:
- ZDB-GENE-041212-13, ZDB-GENE-041212-13
- Description:
- hypothetical protein LOC494049 [Source:RefSeq peptide;Acc:NP_001008592]
- Human Orthologue:
- AIMP1
- Human Description:
- aminoacyl tRNA synthetase complex-interacting multifunctional protein 1 [Source:HGNC Symbol;Acc:1064
- Mouse Orthologue:
- Aimp1
- Mouse Description:
- aminoacyl tRNA synthetase complex-interacting multifunctional protein 1 Gene [Source:MGI Symbol;Acc:
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa30008 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa37799 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa30008
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000053569 | Nonsense | 33 | 282 | 3 | 7 |
ENSDART00000129872 | Nonsense | 33 | 282 | 4 | 8 |
- Genomic Location (Zv9):
- Chromosome 23 (position 44869210)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 45643738 GRCz11 23 45405010 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCTGCAGGCGTCAGTGAGGGAGGAGAAGAAACTGCTGGTAGAAAACGCC[A/T]AACTGAAGAAAGACATCGACGACCTGAAGAACCTGCTGCAGGACACACAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37799
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000053569 | Essential Splice Site | 54 | 282 | 3 | 7 |
ENSDART00000129872 | Essential Splice Site | 54 | 282 | 4 | 8 |
- Genomic Location (Zv9):
- Chromosome 23 (position 44869275)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 45643673 GRCz11 23 45404945 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCGACGACCTGAAGAACCTGCTGCAGGACACACAGAAGAGGAAAGCAGG[T/C]ACTACACACACACACACACACACACACACACACACACACACACACACACA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: