zgc:153935

Ensembl ID:
ENSDARG00000036888
ZFIN ID:
ZDB-GENE-061103-148
Description:
hypothetical protein LOC777611 [Source:RefSeq peptide;Acc:NP_001071187]
Human Orthologue:
CXorf38
Human Description:
chromosome X open reading frame 38 [Source:HGNC Symbol;Acc:28589]
Mouse Orthologue:
1810030O07Rik
Mouse Description:
RIKEN cDNA 1810030O07 gene Gene [Source:MGI Symbol;Acc:MGI:1916405]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10183 Nonsense Available for shipment Available now
sa38093 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10183
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053562   None 303 2 9
ENSDART00000125806 Nonsense 58 414 1 9
ENSDART00000131437   None 67 2 4
ENSDART00000140663   None 321 2 9
ENSDART00000142962   None 50 2 5
ENSDART00000148121   None 173 1 6

The following transcripts of ENSDARG00000036888 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 28588987)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27279081
GRCz11 25 27722283
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTATCACAAGGCTCTGCTAAACAAACAGCAGCTCAGTGGACAACGTTG[T/A]GAGCAAACCTGCAAAAATAATAAGGTAACGTAAATCGTACATAGAAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38093
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053562 Essential Splice Site 41 303 None 9
ENSDART00000125806 Essential Splice Site 152 414 None 9
ENSDART00000131437 Essential Splice Site 59 67 None 4
ENSDART00000140663 Essential Splice Site 59 321 None 9
ENSDART00000142962 Essential Splice Site None 50 None 5
ENSDART00000148121   None 173 None 6

The following transcripts of ENSDARG00000036888 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 28585072)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27275166
GRCz11 25 27718368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTAAACATTTTAAGCCATTTTTGACTAAGGGGGAAAATGTGAAAAAGG[T/A]AAATACTGTTTTCTACCCCTAAGATTTTTCTTTTTGATGTTAAATCATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link