slc2a12

Ensembl ID:
ENSDARG00000036865
ZFIN ID:
ZDB-GENE-040426-1513
Description:
Solute carrier family 2, facilitated glucose transporter member 12 [Source:UniProtKB/Swiss-Prot;Acc:
Human Orthologue:
SLC2A12
Human Description:
solute carrier family 2 (facilitated glucose transporter), member 12 [Source:HGNC Symbol;Acc:18067]
Mouse Orthologue:
Slc2a12
Mouse Description:
solute carrier family 2 (facilitated glucose transporter), member 12 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24373 Nonsense Available for shipment Available now
sa37756 Essential Splice Site Mutation detected in F1 DNA During 2018
sa12272 Essential Splice Site Available for shipment Available now
sa12204 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24373
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053531 Nonsense 456 610 3 6
ENSDART00000143335   None 241 None 3
Genomic Location (Zv9):
Chromosome 23 (position 31858218)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31693108
GRCz11 23 31619639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCTATAATCATAGGACTGCTTTAATGGAAACCGCTGAGCTTTCGAAG[A/T]AAGACAGTGCAAAGATTGCGCTTCAGTCTCTTCACGAAGTGTCGCCTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37756
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053531 Essential Splice Site 494 610 3 6
ENSDART00000143335   None 241 None 3
Genomic Location (Zv9):
Chromosome 23 (position 31858100)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31692990
GRCz11 23 31619521
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCAGCCTGCTGGTGTATGTAGCTGGATTCTCCATCAGCTTGGGACCAA[G/A]TAAGATTCAGACTCAAACAAATGATATCTGTTTATATTACAAATTAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12272
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053531 Essential Splice Site 580 610 5 6
ENSDART00000143335   None 241 None 3
ENSDART00000053531 Essential Splice Site 580 610 5 6
ENSDART00000143335   None 241 None 3
Genomic Location (Zv9):
Chromosome 23 (position 31852204)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31687094
GRCz11 23 31613625
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGACCAAAGGCCGATCATTGGAACAGATCTCAAAGGAACTTGCAATGAA[G/A]TGAGTGGACATAAACACACACATTGGTTTTGGTGGTKTATAAGGACTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12204
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053531 Essential Splice Site 580 610 5 6
ENSDART00000143335   None 241 None 3
ENSDART00000053531 Essential Splice Site 580 610 5 6
ENSDART00000143335   None 241 None 3
Genomic Location (Zv9):
Chromosome 23 (position 31852204)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31687094
GRCz11 23 31613625
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGACCAAAGGCCGATCATTGGAACAGATCTCAAAGGAACTTGCAATGAA[G/A]TGAGTGGACATAAACACACACATTGGTTTTGGTGGTKTATAAGGACTCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link