zgc:91874

Ensembl ID:
ENSDARG00000036846
ZFIN ID:
ZDB-GENE-040704-29
Description:
ankyrin repeat and SAM domain-containing protein 4B [Source:RefSeq peptide;Acc:NP_001002188]
Human Orthologue:
ANKS4B
Human Description:
ankyrin repeat and sterile alpha motif domain containing 4B [Source:HGNC Symbol;Acc:26795]
Mouse Orthologue:
Anks4b
Mouse Description:
ankyrin repeat and sterile alpha motif domain containing 4B Gene [Source:MGI Symbol;Acc:MGI:1919324]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20164 Nonsense Available for shipment Available now
sa33342 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20164
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053494 Nonsense 37 422 1 2
Genomic Location (Zv9):
Chromosome 3 (position 61422081)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 60364971
GRCz11 3 60826799
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAAAGACCTGAACACCCCGGATGAGGACGGCATGACACCCACTCTCT[G/A]GGCGGCCTATCATGGACACATCGAAGCCCTCCAGCTCGTCTGTAGCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33342
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053494 Nonsense 330 422 2 2
Genomic Location (Zv9):
Chromosome 3 (position 61413281)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 60356171
GRCz11 3 60817999
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGTCAGGAGTTGTTTGAAACCGTGGATGAAGGATTGGAAGGTTTGGAT[G/T]AAGATGCAGAGCTGCCCTGGAATGAAGAGGAGATTGGTTTGAATGAGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link