zgc:109868

Ensembl ID:
ENSDARG00000036834
ZFIN IDs:
ZDB-GENE-050417-363, ZDB-GENE-991110-22
Description:
cytokeratin-like [Source:RefSeq peptide;Acc:NP_001017824]
Human Orthologues:
KRT14, KRT16, KRT20, KRT23
Human Descriptions:
keratin 14 [Source:HGNC Symbol;Acc:6416]
keratin 16 [Source:HGNC Symbol;Acc:6423]
keratin 20 [Source:HGNC Symbol;Acc:20412]
keratin 23 (histone deacetylase inducible) [Source:HGNC Symbol;Acc:6438]
Mouse Orthologues:
Krt14, Krt16, Krt20, Krt23
Mouse Descriptions:
keratin 14 Gene [Source:MGI Symbol;Acc:MGI:96688]
keratin 16 Gene [Source:MGI Symbol;Acc:MGI:96690]
keratin 20 Gene [Source:MGI Symbol;Acc:MGI:1914059]
keratin 23 Gene [Source:MGI Symbol;Acc:MGI:2148866]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23426 Essential Splice Site Available for shipment Available now
sa10798 Nonsense Available for shipment Available now
sa12647 Nonsense Available for shipment Available now
sa15492 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23426
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027701 Essential Splice Site 140 390 1 7
ENSDART00000105040 Essential Splice Site 140 431 1 7
Genomic Location (Zv9):
Chromosome 19 (position 5975704)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5435015
GRCz11 19 5351501
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGGGACTACAGTGCCTACTATGCAACAATCAGTGACCTCCAGGTCAAG[G/A]TACTGTATGTGACATGTTAGCCAAGTCAATCATTAAACTACCTTTAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10798
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027701 Nonsense 351 390 6 7
ENSDART00000105040 Nonsense 351 431 6 7
Genomic Location (Zv9):
Chromosome 19 (position 5974548)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5433859
GRCz11 19 5350345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTATCTGGCTACCAGTTCCARGTGAGCAGCCTGGAAGAGCAGCTGGTG[C/T]AGCTTCGTGSTGACCTTGAGCGTCAAAGCCAGGAATACAAGATGCTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12647
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027701 Nonsense 370 390 6 7
ENSDART00000105040 Nonsense 370 431 6 7
Genomic Location (Zv9):
Chromosome 19 (position 5974491)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5433802
GRCz11 19 5350288
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGSTGACCTTGAGCGTCAAAGCCAGGAATACAAGATGCTTCTGGACATC[A/T]AGACCAGACTGGAGATGGAGATTGCAGMGTACAGAAGACTGCTGGATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15492
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027701   390 390 6 7
ENSDART00000105040 Essential Splice Site 390 431 6 7
Genomic Location (Zv9):
Chromosome 19 (position 5974429)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5433740
GRCz11 19 5350226
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGATGGAGATTGCAGMGTACAGAAGACTGCTGGATGGAGAGGCTACAAG[G/A]TGAGACACAACAACACAAGTCTAGTCAAACCAACAGTAAGARTAAACTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link