zgc:92533

Ensembl ID:
ENSDARG00000036830
ZFIN ID:
ZDB-GENE-040801-181
Description:
keratin 12 [Source:RefSeq peptide;Acc:NP_001003445]
Human Orthologues:
KRT14, KRT16, KRT20, KRT23
Human Descriptions:
keratin 14 [Source:HGNC Symbol;Acc:6416]
keratin 16 [Source:HGNC Symbol;Acc:6423]
keratin 20 [Source:HGNC Symbol;Acc:20412]
keratin 23 (histone deacetylase inducible) [Source:HGNC Symbol;Acc:6438]
Mouse Orthologues:
Krt14, Krt16, Krt20, Krt23
Mouse Descriptions:
keratin 14 Gene [Source:MGI Symbol;Acc:MGI:96688]
keratin 16 Gene [Source:MGI Symbol;Acc:MGI:96690]
keratin 20 Gene [Source:MGI Symbol;Acc:MGI:1914059]
keratin 23 Gene [Source:MGI Symbol;Acc:MGI:2148866]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43210 Nonsense Mutation detected in F1 DNA During 2018
sa29143 Nonsense Mutation detected in F1 DNA During 2018
sa16968 Nonsense Available for shipment Available now
sa36767 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43210
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000221   None 466 None 7
ENSDART00000104995   None 351 None 10
ENSDART00000105803 Nonsense 511 844 7 13
ENSDART00000146890   None 463 None 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 5993362)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5452673
GRCz11 19 5369159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAATGAGAAAGCCACCATGCAAAACCTCAATGATCGTCTGGCCTCCTA[C/A]CTGGAGAAGGTGCGCATCCTGGAGAAGGAAAACGCAGATCTTGAGCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29143
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000221   None 466 None 7
ENSDART00000104995   None 351 None 10
ENSDART00000105803 Nonsense 687 844 10 13
ENSDART00000146890   None 463 None 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 5987607)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5446918
GRCz11 19 5363404
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCACTACGAGGCAGTTTCTGCCAAGAACCGTAAAGATCTTGAGAGTTG[G/A]TTCCAGGCCAAGGTAAAAATCTGTTTTAACATGTCAAATTTGTTTAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16968
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000221   None 466 None 7
ENSDART00000104995   None 351 None 10
ENSDART00000105803 Nonsense 691 844 10 13
ENSDART00000146890   None 463 None 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 5987597)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5446908
GRCz11 19 5363394
KASP Assay ID:
2261-2858.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCAGTTTCTGCCAAGAACCGTAAAGWTCTTGAGAGTTGGTTCCAGGCC[A/T]AGGTAAAAATCTGWTTTAACATGTCAAATTTGTTTAGCAAGATGGAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36767
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000221   None 466 None 7
ENSDART00000104995   None 351 None 10
ENSDART00000105803 Nonsense 817 844 13 13
ENSDART00000146890   None 463 None 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 5986922)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5446233
GRCz11 19 5362719
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCATATTTCTATTTCTCCAGTGTTTCCACAAGCTCAAGCACTACACGC[A/T]AAGTGGTAACCATTGTGGAAGAGGTGGTGGATGGAAAAGTGGTCAGCTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link