
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000036829
- Ensembl ID:
- ENSDARG00000036829
- Human Orthologue:
- L1TD1
- Human Description:
- LINE-1 type transposase domain containing 1 [Source:HGNC Symbol;Acc:25595]
- Mouse Orthologue:
- L1td1
- Mouse Description:
- LINE-1 type transposase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:3578435]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35662 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa42366 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa2768 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa35662
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000053471 | Nonsense | 18 | 328 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 14 (position 17322645)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 13601086 GRCz11 14 13906649 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAGCTATGGAACGAAGGGGAAGACAAAAAAGAAACACGCCAAAAGACGAC[G/T]AAAACAACCCAAATGTACCTGAGCAAACTAGCACGAGCGGCGACGCTAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42366
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000053471 | Nonsense | 81 | 328 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 14 (position 17322456)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 13601275 GRCz11 14 13906838 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCAAGACATAAAAGAAGAATTAAACAAGTCCAATAAAAGAATCGAAGAG[G/T]GACTTCCGGTTATGGAGTGGTAGCGAAAAGACGTGAGATAACGACCCTCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa2768
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000053471 | Nonsense | 193 | 328 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 14 (position 17321911)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 13601820 GRCz11 14 13907383 - KASP Assay ID:
- 554-3378.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGGAAAACAGAAACAGAYGGAACAACCTGAGGCTAGTGGGTTTGCCGGAA[C/T]GAGAAGAGGGGGCAGAYGCGGGTGCGTTTTTGGAGGACTTTATTCCAAAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: