zgc:101056

Ensembl ID:
ENSDARG00000036784
ZFIN ID:
ZDB-GENE-040801-96
Description:
COMM domain-containing protein 7 [Source:RefSeq peptide;Acc:NP_001003577]
Human Orthologue:
COMMD7
Human Description:
COMM domain containing 7 [Source:HGNC Symbol;Acc:16223]
Mouse Orthologue:
Commd7
Mouse Description:
COMM domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:1914197]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24285 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24285
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053414 Nonsense 101 200 5 9
Genomic Location (Zv9):
Chromosome 23 (position 17281381)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 17184320
GRCz11 23 17110663
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTTTCCATGTAGTTAATATTTAACAATATGATAAACTCTTACAGGAT[T/A]AAATGAAGACAAGGCCAGTCATTTCTCTGACCAGGTACTACTGTATATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link