zgc:100795

Ensembl ID:
ENSDARG00000036775
ZFIN ID:
ZDB-GENE-040822-45
Description:
Probable D-tyrosyl-tRNA(Tyr) deacylase 2 [Source:UniProtKB/Swiss-Prot;Acc:Q68EL2]
Human Orthologue:
C14orf126
Human Description:
chromosome 14 open reading frame 126 [Source:HGNC Symbol;Acc:20277]
Mouse Orthologue:
6530401N04Rik
Mouse Description:
RIKEN cDNA 6530401N04 gene Gene [Source:MGI Symbol;Acc:MGI:1923485]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42963 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42963
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053400 Nonsense 89 160 3 3
ENSDART00000136199 Nonsense 97 168 3 3
Genomic Location (Zv9):
Chromosome 17 (position 31776661)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 31700588
GRCz11 17 31717551
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTCTTCAGCTACCTGGCAGTGTTCTCATTGTACCACAAGCCACACTC[G/T]GAGGAAAACCGAAGGGACGAGGGATGCAGTACCACGGCAATATTGGGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link