TAF4 (1 of 2)

Ensembl ID:
ENSDARG00000036750
Description:
TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa [Source:HGNC Symbol
Human Orthologue:
TAF4
Human Description:
TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa [Source:HGNC Symbol
Mouse Orthologue:
Taf4a
Mouse Description:
TAF4A RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI Symbol;Ac

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30945 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30945
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053362 Nonsense 71 121 3 3
Genomic Location (Zv9):
Chromosome 11 (position 21264223)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 20787381
GRCz11 11 20888693
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGAGTTTGTGAAAGTTTGTGTGTGTGTTTTGGCAGGGCTCAGGTTTGTG[C/A]GCGAGTGCATCCGGGGGCTTAAATGCAGGAGCGTCGAGGCAGTTCACTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link