znf865

Ensembl ID:
ENSDARG00000036698
ZFIN ID:
ZDB-GENE-060503-896
Description:
zinc finger protein 865 [Source:RefSeq peptide;Acc:NP_001076544]
Human Orthologue:
ZNF865
Human Description:
zinc finger protein 865 [Source:HGNC Symbol;Acc:38705]
Mouse Orthologue:
Zfp865
Mouse Description:
zinc finger protein 865 Gene [Source:MGI Symbol;Acc:MGI:2442656]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43234 Nonsense Mutation detected in F1 DNA During 2018
sa43233 Nonsense Mutation detected in F1 DNA During 2018
sa23453 Nonsense Available for shipment Available now
sa16969 Nonsense Available for shipment Available now
sa36790 Nonsense Mutation detected in F1 DNA During 2018
sa43232 Nonsense Mutation detected in F1 DNA During 2018
sa23452 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43234
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053300 Nonsense 686 1506 1 1
Genomic Location (Zv9):
Chromosome 19 (position 10827437)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10285976
GRCz11 19 10204901
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCAATAGGTTCAGTGGATGGCAAAGTTGAAACCGATTTTCCTGGTGGA[C/T]AGATTACTGACACAAAAGATTTGGTATTTTGCAAGAATGAGGATAGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43233
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053300 Nonsense 729 1506 1 1
Genomic Location (Zv9):
Chromosome 19 (position 10827306)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10285845
GRCz11 19 10204770
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCAAGAAATGCTAATCAAAACCCTATTGGCAAACCTAAAGAAGAGTA[T/A]AATCCTGAGTATTCAAGAGATCCTTACCAAACGTCATACAGGGTCGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23453
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053300 Nonsense 1084 1506 1 1
Genomic Location (Zv9):
Chromosome 19 (position 10826241)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10284780
GRCz11 19 10203705
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCAAGGATCTAATGCGAGCACAAGCAACCAACCCCCTCCAAAGCTATA[T/G]ACATGTGAGATTTGCTGGAAATCTTTCCGCCATCACTTCCATTTGACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16969
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053300 Nonsense 1184 1506 1 1
Genomic Location (Zv9):
Chromosome 19 (position 10825943)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10284482
GRCz11 19 10203407
KASP Assay ID:
2261-2990.2 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACCAATGCACTCCTTCATATATCACCTGAAAGTGGRAGTCATGGAGTA[C/T]AACAGCCCCATYCAACGATTGCTCACACGCAGCATCCTCAGCCTGCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36790
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053300 Nonsense 1315 1506 1 1
Genomic Location (Zv9):
Chromosome 19 (position 10825550)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10284089
GRCz11 19 10203014
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGGAAGAAAAAAAAAAAAAAGAAAAAATATAAACTGCCGTTGATAACT[G/T]GATTCAGTGCTTATGAAATTGCCAGGAGGCAAATGTATTTAAAACGGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43232
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053300 Nonsense 1454 1506 1 1
Genomic Location (Zv9):
Chromosome 19 (position 10825133)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10283672
GRCz11 19 10202597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCTGTCATCGGGCCCAGCATCTCTCTCAAGGGGGGTTCTCTTGCTCA[C/T]GATGTCCCTCACGATTCTGGAACGGCACTCTCCTACAGCGCCACAAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23452
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053300 Nonsense 1466 1506 1 1
Genomic Location (Zv9):
Chromosome 19 (position 10825097)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 10283636
GRCz11 19 10202561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTCTCTTGCTCACGATGTCCCTCACGATTCTGGAACGGCACTCTCCTA[C/T]AGCGCCACAAATTTGCTTGTCGTCGTGTCAGTAGAGGAATCAGAATGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link