
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
arl11
- Ensembl ID:
- ENSDARG00000036637
- ZFIN ID:
- ZDB-GENE-030131-3410
- Description:
- ADP-ribosylation factor-like protein 11 [Source:RefSeq peptide;Acc:NP_955987]
- Human Orthologue:
- ARL11
- Human Description:
- ADP-ribosylation factor-like 11 [Source:HGNC Symbol;Acc:24046]
- Mouse Orthologue:
- Arl11
- Mouse Description:
- ADP-ribosylation factor-like 11 Gene [Source:MGI Symbol;Acc:MGI:2444054]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10476 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa10476
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000053221 | Nonsense | 7 | 176 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 1 (position 47149852)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 45961513 GRCz11 1 46652745 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCAACCCWTCGTAAGCTCATCCAGGATCCAAAATGGGCGCCATCAAGTCC[A/T]AACGGTTTAAAARGCCTCCTCAGGTGCTCATCATGGGCTTGGATTCAGCA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Multiple sclerosis: A genome-wide association study of brain lesion distribution in multiple sclerosis. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: