zgc:92790

Ensembl ID:
ENSDARG00000036625
ZFIN ID:
ZDB-GENE-040718-279
Description:
hypothetical protein LOC436817 [Source:RefSeq peptide;Acc:NP_001002544]
Human Orthologue:
POLR2F
Human Description:
polymerase (RNA) II (DNA directed) polypeptide F [Source:HGNC Symbol;Acc:9193]
Mouse Orthologue:
Polr2f
Mouse Description:
polymerase (RNA) II (DNA directed) polypeptide F Gene [Source:MGI Symbol;Acc:MGI:1349393]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25972 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25972
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053201 Essential Splice Site 74 127 3 5

The following transcripts of ENSDARG00000036625 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 2574627)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 2036048
GRCz11 3 1515165
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAAATACGAGAGAGCGCGAGTGCTGGGAACACGAGCTCTGCAGATCGC[G/A]TGAGTGACTGATCCACAATCACCACTCAACACAACACACACACACACTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link