FAM193A
- Ensembl ID:
- ENSDARG00000036595
- Description:
- family with sequence similarity 193, member A [Source:HGNC Symbol;Acc:16822]
- Human Orthologue:
- FAM193A
- Human Description:
- family with sequence similarity 193, member A [Source:HGNC Symbol;Acc:16822]
- Mouse Orthologue:
- Fam193a
- Mouse Description:
- family with sequence similarity 193, member A Gene [Source:MGI Symbol;Acc:MGI:2447768]
Alleles
There are 6 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa7383 |
Missense |
Mutation detected in F1 DNA |
During 2018 |
sa9068 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa18701 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa31215 |
Essential Splice Site |
Available for shipment |
Available now |
sa14151 |
Essential Splice Site |
Available for shipment |
Available now |
sa14253 |
Essential Splice Site |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa7383
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > C
- Consequence:
- Missense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000075216 |
Missense |
254 |
1476 |
5 |
23 |
- Genomic Location (Zv9):
- Chromosome 1 (position 37177402)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
36607850 |
GRCz11 |
1 |
37327179 |
- KASP Assay ID:
- 554-4199.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GTCAGACTGGGACTCCACTGGCTGACGATCAGGATCAGCCTCTCGATCGG[G/C]ACAAAGAGAGCATGAAGGAACTTGTTGACAGGTACTCTTGAATGACTTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9068
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 1 (position 37180682)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
36611130 |
GRCz11 |
1 |
37330459 |
- KASP Assay ID:
- 2259-0817.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TTAGGCTTTGTGAGAAGGATCCCTACCAGTTGTACCAGCGTCTAGARCAG[C/T]AGGCAAGAGAGTACGTCTTAGAGATGAAGGTGCGGCTGCTCAAACACCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18701
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 1 (position 37180682)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
36611130 |
GRCz11 |
1 |
37330459 |
- KASP Assay ID:
- 2259-0817.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTAGGCTTTGTGAGAAGGATCCCTACCAGTTGTACCAGCGTCTAGAACAG[C/T]AGGCAAGAGAGTACGTCTTAGAGATGAAGGTGCGGCTGCTCAAACACCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31215
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000075216 |
Essential Splice Site |
854 |
1476 |
16 |
23 |
- Genomic Location (Zv9):
- Chromosome 1 (position 37197736)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
36649852 |
GRCz11 |
1 |
37347513 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATGATGAAGAACTGGAACCCTTCTGTGCTGCTCCAGGAACCACTGCCTG[G/A]TCAGTTCCATAAGCCCTTTTTAAAGATGTTTCGCCCACTTCAAAGCAGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14151
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000075216 |
Essential Splice Site |
1419 |
1476 |
21 |
23 |
ENSDART00000075216 |
Essential Splice Site |
1419 |
1476 |
21 |
23 |
- Genomic Location (Zv9):
- Chromosome 1 (position 37209876)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
36661767 |
GRCz11 |
1 |
37359428 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GCTAAGAAGAATAAGAAGAAAAAAGGAGATAAGATGAATAACTCAATAGG[T/C]YAGTTTTGTCAAGTGCTCAAGATAAATGATAAAAAGAAGGGCTTTTAACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14253
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000075216 |
Essential Splice Site |
1419 |
1476 |
21 |
23 |
ENSDART00000075216 |
Essential Splice Site |
1419 |
1476 |
21 |
23 |
- Genomic Location (Zv9):
- Chromosome 1 (position 37209876)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
36661767 |
GRCz11 |
1 |
37359428 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GCTAAGAAGAATAAGAAGAAAAAAGGAGATAAGATGAATAACTCAATAGG[T/C]YAGTTTTGTCAAGTGCTCAAGATAAATGATAAAAAGAAGGGCTTTTAACA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: