zgc:85787

Ensembl ID:
ENSDARG00000036593
ZFIN ID:
ZDB-GENE-040426-2195
Description:
Zgc:85787 protein [Source:UniProtKB/TrEMBL;Acc:A2RV13]
Human Orthologue:
KDM2B
Human Description:
lysine (K)-specific demethylase 2B [Source:HGNC Symbol;Acc:13610]
Mouse Orthologue:
Kdm2b
Mouse Description:
lysine (K)-specific demethylase 2B Gene [Source:MGI Symbol;Acc:MGI:1354737]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21355 Nonsense Available for shipment Available now
sa10959 Nonsense Available for shipment Available now
sa44693 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa21355
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053158 Nonsense 256 820 5 9
Genomic Location (Zv9):
Chromosome 8 (position 42295229)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 40212198
GRCz11 8 40251799
KASP Assay ID:
2260-0953.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCCCAGATTGAAGACTGAGGATTTACCCTCACGCCTTCCCCCACTGT[T/A]GTCCCCAAGTGGCCTGCCAAGACCACGATCTGAAGTGCCCAACTTCTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10959
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053158 Nonsense 469 820 6 9
Genomic Location (Zv9):
Chromosome 8 (position 42294512)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 40211481
GRCz11 8 40251082
KASP Assay ID:
2260-0952.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTCAGTGCAGAGCTCAGCAAGCAGCTCAACATGGAGATCCGTCGCACA[G/T]AACATTCACTGRCCAATGAAAACCAGCAGCCACTAAWRAGCGAACCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44693
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053158 Nonsense 604 820 6 9
Genomic Location (Zv9):
Chromosome 8 (position 42294105)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 40211074
GRCz11 8 40250675
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACTACCACTAGCTGATGGTCGTAATCACATAGCTCCCAGAGAGGCATG[G/A]CTGGCCATCTTCAGCCACTTGAGCCATCGTGAACTTTGTGTGTGTATGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link