zgc:64115

Ensembl ID:
ENSDARG00000036588
ZFIN ID:
ZDB-GENE-040426-2149
Description:
major histocompatibility complex class I ZE like [Source:RefSeq peptide;Acc:NP_001103588]
Human Orthologues:
AL645933.1, AZGP1, FCGRT, HFE, MICB, MR1
Human Descriptions:
alpha-2-glycoprotein 1, zinc-binding [Source:HGNC Symbol;Acc:910]
Fc fragment of IgG, receptor, transporter, alpha [Source:HGNC Symbol;Acc:3621]
hemochromatosis [Source:HGNC Symbol;Acc:4886]
major histocompatibility complex, class I-related [Source:HGNC Symbol;Acc:4975]
MHC class I polypeptide-related sequence A isoform 2 (MICA*00801) precursor [Source:RefSeq peptide;
MHC class I polypeptide-related sequence B [Source:HGNC Symbol;Acc:7091]
Mouse Orthologues:
Azgp1, CR974466.3, Fcgrt, Gm11127, Gm7030, Gm8815, Gm8909, H2-Bl, H2-D1, H2-gs10, H2-K1, H2-K2, H2-M2, H2-M3, H2-Q10, H2-Q2, H2-Q6, H2-Q7, H2-Q8, H2-T10, H2-T22, H2-T23, H2-T3, Hfe, Mill1, Mill2, Mr1
Mouse Descriptions:
alpha-2-glycoprotein 1, zinc Gene [Source:MGI Symbol;Acc:MGI:103163]
Fc receptor, IgG, alpha chain transporter Gene [Source:MGI Symbol;Acc:MGI:103017]
hemochromatosis Gene [Source:MGI Symbol;Acc:MGI:109191]
histocompatibility 2, blastocyst Gene [Source:MGI Symbol;Acc:MGI:892004]
histocompatibility 2, D region locus 1 Gene [Source:MGI Symbol;Acc:MGI:95896]
histocompatibility 2, K region locus 2 Pseudogene [Source:MGI Symbol;Acc:MGI:95906]
histocompatibility 2, K1, K region Gene [Source:MGI Symbol;Acc:MGI:95904]
histocompatibility 2, M region locus 2 Gene [Source:MGI Symbol;Acc:MGI:95914]
histocompatibility 2, M region locus 3 Gene [Source:MGI Symbol;Acc:MGI:95915]
histocompatibility 2, Q region locus 10 Gene [Source:MGI Symbol;Acc:MGI:95929]
histocompatibility 2, Q region locus 2 [Source:RefSeq peptide;Acc:NP_034522]
histocompatibility 2, Q region locus 2 Gene [Source:MGI Symbol;Acc:MGI:95931]
histocompatibility 2, Q region locus 6 Gene [Source:MGI Symbol;Acc:MGI:95935]
histocompatibility 2, Q region locus 7 Gene [Source:MGI Symbol;Acc:MGI:95936]
histocompatibility 2, Q region locus 8 Gene [Source:MGI Symbol;Acc:MGI:95937]
histocompatibility 2, T region locus 10 Gene [Source:MGI Symbol;Acc:MGI:95942]
histocompatibility 2, T region locus 22 Gene [Source:MGI Symbol;Acc:MGI:95956]
histocompatibility 2, T region locus 23 Gene [Source:MGI Symbol;Acc:MGI:95957]
histocompatibility 2, T region locus 3 Gene [Source:MGI Symbol;Acc:MGI:95959]
major histocompatibility complex, class I-related Gene [Source:MGI Symbol;Acc:MGI:1195463]
MHC class I like protein GS10 Gene [Source:MGI Symbol;Acc:MGI:3808875]
MHC I like leukocyte 1 Gene [Source:MGI Symbol;Acc:MGI:2179988]
MHC I like leukocyte 2 Gene [Source:MGI Symbol;Acc:MGI:2179989]
predicted gene 11127 Gene [Source:MGI Symbol;Acc:MGI:3779381]
predicted gene 7030 Pseudogene [Source:MGI Symbol;Acc:MGI:3647514]
predicted gene 8815 Pseudogene [Source:MGI Symbol;Acc:MGI:3648635]
predicted gene 8909 Gene [Source:MGI Symbol;Acc:MGI:3704134]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32754 Nonsense Available for shipment Available now
sa16226 Essential Splice Site Available for shipment Available now
sa19563 Nonsense Available for shipment Available now
sa32753 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32754
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053153 Nonsense 69 398 2 9
Genomic Location (Zv9):
Chromosome 1 (position 47657852)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46469513
GRCz11 1 47160745
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACAGACAGATTGACTATTACAATAGCGAACAGCAGAAGAAGATTCCC[A/T]AACAGCACTGGATGAAAGAGAAAATGCAGGAAGATTACTGGGAAAAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16226
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053153 Essential Splice Site 209 398 4 9
Genomic Location (Zv9):
Chromosome 1 (position 47656386)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46468047
GRCz11 1 47159279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGGTTAGTGTTATAKAACTGACTGATTAAACAATRTACTTGTGATTTC[A/G]GCTTCCCCAGAAGTTCATGTGTTWGCGAAGAGGATTATCARTGGCAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19563
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053153 Nonsense 247 398 4 9
Genomic Location (Zv9):
Chromosome 1 (position 47656271)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46467932
GRCz11 1 47159164
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGTCTGGCCACTGGATTCTACCCCAAAGATGTGATTTTGAACATAAGG[A/T]AATACCGCATTACACTGCCTGATAATGAGGTAGAATCCACAGGAGTTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32753
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053153 Essential Splice Site 398 398 8 9
Genomic Location (Zv9):
Chromosome 1 (position 47654679)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46466340
GRCz11 1 47157572
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTTCAAAAAGCAGTCCTACTAACTCACAGGAAAAAATGGACATTGTGG[T/A]AACTATGATTTACATGCAATATTAGTAAAGCCAGAGGGTCCACTGTATAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link