st8sia5

Ensembl ID:
ENSDARG00000036584
ZFIN ID:
ZDB-GENE-060322-8
Description:
Alpha 2,8-sialyltransferase ST8Sia V [Source:UniProtKB/TrEMBL;Acc:Q0P7H3]
Human Orthologue:
ST8SIA5
Human Description:
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5 [Source:HGNC Symbol;Acc:17827]
Mouse Orthologue:
St8sia5
Mouse Description:
ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5 Gene [Source:MGI Symbol;Acc:MGI:109243]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11310 Essential Splice Site Available for shipment Available now
sa6662 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa11310
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053148   None 343 None 6
ENSDART00000102536 Essential Splice Site 75 374 2 7
ENSDART00000102539 Essential Splice Site 111 410 3 8
ENSDART00000125859   None 356 None 14
ENSDART00000130569 Essential Splice Site 144 443 4 9
ENSDART00000146400   None 111 None 3
Genomic Location (Zv9):
Chromosome 21 (position 5470409)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 5066553
GRCz11 21 5231118
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGCAAGGAACTACGRCAAGACATCACAGATGTCRAAGTATTGACCAT[G/A]TAAGTTCCTGCTTCAGATCGAGCGCTCCAGYGGGACTCAAATTTCCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6662
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053148 Nonsense 288 343 6 6
ENSDART00000102536 Nonsense 319 374 7 7
ENSDART00000102539 Nonsense 355 410 8 8
ENSDART00000125859 Nonsense 302 356 14 14
ENSDART00000130569 Nonsense 388 443 9 9
ENSDART00000146400   None 111 None 3
Genomic Location (Zv9):
Chromosome 21 (position 5479718)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 5075862
GRCz11 21 5240427
KASP Assay ID:
554-4437.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGATGCTGGTCACCGCTGCCATGGAGCTCTGCGAAGAAGTGCATCTCTA[C/A]GGMTTCTGGGCGTTTCCCATGAACCCCTCYGGYATCTTCATAACACACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link