aanat1

Ensembl ID:
ENSDARG00000036567
ZFIN ID:
ZDB-GENE-040329-1
Description:
serotonin N-acetyltransferase [Source:RefSeq peptide;Acc:NP_956998]
Human Orthologue:
AANAT
Human Description:
aralkylamine N-acetyltransferase [Source:HGNC Symbol;Acc:19]
Mouse Orthologue:
Aanat
Mouse Description:
arylalkylamine N-acetyltransferase Gene [Source:MGI Symbol;Acc:MGI:1328365]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33859 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33859
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053126 Nonsense 110 204 3 3
ENSDART00000134559 Nonsense 123 148 3 3
Genomic Location (Zv9):
Chromosome 6 (position 22267127)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 18520162
GRCz11 6 23618081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTTTACTATTTAATTTTGTCTCTTTTTAGGATGCACTGACCCTTCAT[A/T]AACCTCATGGAACTACTGTTCACATCCATGTGCTGGCAGTCCATCGGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link