si:dkey-22n8.2

Ensembl ID:
ENSDARG00000036545
ZFIN IDs:
ZDB-GENE-030616-522, ZDB-GENE-090312-200
Description:
Novel protein similar to vertebrate transmembrane protease, serine 3 (TMPRSS3) [Source:UniProtKB/TrE
Human Orthologue:
TMPRSS3
Human Description:
transmembrane protease, serine 3 [Source:HGNC Symbol;Acc:11877]
Mouse Orthologue:
Tmprss3
Mouse Description:
transmembrane protease, serine 3 Gene [Source:MGI Symbol;Acc:MGI:2155445]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32750 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32750
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053099 Nonsense 294 430 8 11
ENSDART00000132843 Nonsense 170 326 4 7
Genomic Location (Zv9):
Chromosome 1 (position 47453331)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 46264992
GRCz11 1 46956224
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGAAGCTCATTCTGTGGAGAAAATCATCTACCATGCCAACTTCAGGT[C/A]AAAAAGCTTCAGCTACGACATAGCGCTGATAAAGCTTGCACTACCTCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link