zgc:91984

Ensembl ID:
ENSDARG00000036541
ZFIN ID:
ZDB-GENE-040704-75
Description:
Rhomboid family member 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6GMF8]
Human Orthologue:
RHBDF1
Human Description:
rhomboid 5 homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:20561]
Mouse Orthologue:
Rhbdf1
Mouse Description:
rhomboid family 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:104328]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33326 Nonsense Mutation detected in F1 DNA During 2018
sa33325 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33326
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053095 Nonsense 447 857 10 18
ENSDART00000145766   None 125 None 4
Genomic Location (Zv9):
Chromosome 3 (position 55762081)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54655807
GRCz11 3 54910409
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTTTGTCAACACACTTGTTTTTTCCCTCCACAAAGGTCTTAAGAAAT[A/T]AAGGCGTCTATGAAAATGTCAAATTTGTGCAGCAAGAGAACTTTTGGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33325
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053095 Nonsense 482 857 11 18
ENSDART00000145766   None 125 None 4
Genomic Location (Zv9):
Chromosome 3 (position 55759695)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54653421
GRCz11 3 54908023
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGTCAGGAGGCCCTGATTCACCTGGGAGCCAAATTCTCACCTTGTATG[C/T]GACGGGACAACCAGGTACATGAACTGATTAAAAAAAAGCAGGAACTGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link