zgc:162976

Ensembl ID:
ENSDARG00000036482
ZFIN ID:
ZDB-GENE-030131-4637
Description:
Protein HEXIM [Source:UniProtKB/Swiss-Prot;Acc:A5D8S8]
Human Orthologues:
HEXIM1, HEXIM2
Human Descriptions:
hexamethylene bis-acetamide inducible 1 [Source:HGNC Symbol;Acc:24953]
hexamthylene bis-acetamide inducible 2 [Source:HGNC Symbol;Acc:28591]
Mouse Orthologues:
Hexim1, Hexim2
Mouse Descriptions:
hexamethylene bis-acetamide inducible 1 Gene [Source:MGI Symbol;Acc:MGI:2385923]
hexamthylene bis-acetamide inducible 2 Gene [Source:MGI Symbol;Acc:MGI:1918309]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22060 Nonsense Available for shipment Available now
sa35236 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22060
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053003 Nonsense 58 319 2 2
Genomic Location (Zv9):
Chromosome 12 (position 16413108)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15524073
GRCz11 12 15566380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGGTGTCAGGAGATGTGCATCCAATGTGTCGGGATCGGAGTGATCCT[G/T]AGCCCAGGACTGGCGATGCAGCAAGTGACGACGGGTTTCCTGCAGACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35236
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053003 Nonsense 96 319 2 2
Genomic Location (Zv9):
Chromosome 12 (position 16412994)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15523959
GRCz11 12 15566266
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACTCTGAATGCGCGGCAGTAAACACCGATGGGGTGTCTGATGGCCGC[C/T]AGGGCAAAAAGAAACACAGACGGCGACCCTCCAAGAAGAAGCGCCGCTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link