si:ch211-102c2.6

Ensembl ID:
ENSDARG00000036481
ZFIN ID:
ZDB-GENE-030131-4648
Description:
transcobalamin-2 [Source:RefSeq peptide;Acc:NP_001116703]
Human Orthologues:
GIF, TCN1, TCN2
Human Descriptions:
gastric intrinsic factor (vitamin B synthesis) [Source:HGNC Symbol;Acc:4268]
transcobalamin I (vitamin B12 binding protein, R binder family) [Source:HGNC Symbol;Acc:11652]
transcobalamin II [Source:HGNC Symbol;Acc:11653]
Mouse Orthologues:
Gif, Tcn2
Mouse Descriptions:
gastric intrinsic factor Gene [Source:MGI Symbol;Acc:MGI:1202394]
transcobalamin 2 Gene [Source:MGI Symbol;Acc:MGI:98534]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16018 Nonsense Available for shipment Available now
sa33607 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45202 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40433 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa16018
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053001 Nonsense 67 423 3 10
ENSDART00000145631 Nonsense 67 245 3 6
ENSDART00000145736   None 180 None 5
Genomic Location (Zv9):
Chromosome 5 (position 28443360)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26198658
GRCz11 5 26798811
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCGCTCTGCGGCTCTCCACACAACATAACCTGGACAAAGAAAACCAATA[T/A]CTCAACCGCCTCAAGAAAGAGTTTCAYGAGGATATTGARAAGTACAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33607
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053001 Essential Splice Site 81 423 3 10
ENSDART00000145631 Essential Splice Site 81 245 3 6
ENSDART00000145736   None 180 None 5
Genomic Location (Zv9):
Chromosome 5 (position 28443402)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26198700
GRCz11 5 26798853
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCAATATCTCAACCGCCTCAAGAAAGAGTTTCATGAGGATATTGAGAA[G/A]TACAAATCTTTTCAGCTTCAACTTTAAAGCAGCAGTTTCTTATTTCGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45202
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053001 Essential Splice Site 245 423 None 10
ENSDART00000145631   245 245 6 6
ENSDART00000145736 Essential Splice Site 162 180 None 5
Genomic Location (Zv9):
Chromosome 5 (position 28446937)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26202235
GRCz11 5 26802388
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGATGGTCACATGGGCAATGAATTCAGCACGGGCTTGGCAGTGCAGG[T/C]AATAGGAATAAAATGAAATCCATTTATTCATTTATTTTCCTTCGGCTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40433
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053001 Nonsense 372 423 9 10
ENSDART00000145631   None 245 None 6
ENSDART00000145736   None 180 None 5
Genomic Location (Zv9):
Chromosome 5 (position 28449952)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26205250
GRCz11 5 26805403
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACAATTTTGCTTTCTGCATGACAGCTTTAAGACTGAAGACAGCTTGTG[G/A]GGAGCTTTTCTCAGTGTGCTCAATGATGAGCAAGCCCGTCAGACTGATCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link