si:dkeyp-80c12.4

Ensembl ID:
ENSDARG00000036479
ZFIN ID:
ZDB-GENE-090313-403
Description:
Novel protein similar to vertebrate inositol 1,4,5-triphosphate receptor interacting protein [Source
Human Orthologue:
ITPRIP
Human Description:
inositol 1,4,5-triphosphate receptor interacting protein [Source:HGNC Symbol;Acc:29370]
Mouse Orthologue:
Itprip
Mouse Description:
inositol 1,4,5-triphosphate receptor interacting protein Gene [Source:MGI Symbol;Acc:MGI:3042776]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19577 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19577
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052998 Nonsense 376 687 2 2
Genomic Location (Zv9):
Chromosome 1 (position 50018005)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 48867186
GRCz11 1 49511606
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCCATCATCCCACCAAAGTCGTGTAGCTTTGAGTTTACGCTTTTGAAA[G/T]AAAATAGAGGTTCAACTGCACAGAACAGTTGCAGAATCAAGATGGTAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link