si:dkey-234p10.2

Ensembl ID:
ENSDARG00000036457
ZFIN ID:
ZDB-GENE-060503-440
Description:
voltage-dependent calcium channel gamma-6 subunit [Source:RefSeq peptide;Acc:NP_001076560]
Human Orthologue:
CACNG6
Human Description:
calcium channel, voltage-dependent, gamma subunit 6 [Source:HGNC Symbol;Acc:13625]
Mouse Orthologue:
Cacng6
Mouse Description:
calcium channel, voltage-dependent, gamma subunit 6 Gene [Source:MGI Symbol;Acc:MGI:1859168]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11803 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11803
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052967 Nonsense 15 257 2 5
ENSDART00000138310 Nonsense 35 277 1 4
Genomic Location (Zv9):
Chromosome 19 (position 10413444)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9871983
GRCz11 19 9790908
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCGGGRGGCCACCAACCATCCGGGGGACTGGACGGATTTTTGGSATCA[C/T]GAGGCAAAGGACGCAAGCGAAGAYACAGAACACAATCCGGATCCGGAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link