
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:113025
- Ensembl ID:
- ENSDARG00000036445
- ZFIN ID:
- ZDB-GENE-050417-12
- Description:
- hypothetical protein LOC554550 [Source:RefSeq peptide;Acc:NP_001017564]
- Human Orthologue:
- SERPINH1
- Human Description:
- serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)
- Mouse Orthologue:
- Serpinh1
- Mouse Description:
- serine (or cysteine) peptidase inhibitor, clade H, member 1 Gene [Source:MGI Symbol;Acc:MGI:88283]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12866 | Nonsense | Available for shipment | Available now |
sa654 | Nonsense | F2 line generated | During 2018 |
sa34047 | Nonsense | Available for shipment | Available now |
sa16240 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12866
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052942 | Nonsense | 74 | 414 | 2 | 5 |
ENSDART00000127009 | Nonsense | 74 | 414 | 1 | 4 |
- Genomic Location (Zv9):
- Chromosome 7 (position 22443858)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 21009043 GRCz11 7 21275381 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CGGTTCCCAGACCAACACCYTCATCYCCCCGCTTCTGTTGGCCAACTCCT[T/A]GCTGGCTCTAGGGGGTGGAGCRAAAGGATCCACAGYYAGCCAGTTTCATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa654
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052942 | Nonsense | 110 | 414 | 2 | 5 |
ENSDART00000127009 | Nonsense | 110 | 414 | 1 | 4 |
- Genomic Location (Zv9):
- Chromosome 7 (position 22443965)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 21009150 GRCz11 7 21275488 - KASP Assay ID:
- 554-0562.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGAGGATCACCAAAAATGAGAATGTGGTAGGAGAGACTTTGACCACAGCA[C/T]AGAAGGCTGTGCATGAATCAAATGGGACCAGCTACATATTGCACAGTTCC
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa34047
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052942 | Nonsense | 216 | 414 | 3 | 5 |
ENSDART00000127009 | Nonsense | 216 | 414 | 2 | 4 |
- Genomic Location (Zv9):
- Chromosome 7 (position 22458051)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 21023236 GRCz11 7 21289574 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGATCTTTTTGTTTCAGGATTGTGGGATCGAGGCTTTTACCATGAAAAC[C/T]AAGATGTGCGCAGCTTCCTAGGAACCAAATACACTAAAGTTCCCATGATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16240
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052942 | Nonsense | 241 | 414 | 4 | 5 |
ENSDART00000127009 | Nonsense | 241 | 414 | 3 | 4 |
- Genomic Location (Zv9):
- Chromosome 7 (position 22459925)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 21025110 GRCz11 7 21291448 - KASP Assay ID:
- 2259-8697.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CYAAGACTCCCYATGCTAAATGCTTGTATCCTAGGTGTGTACCGTCATTA[C/A]GAGGACATGGAGAACATGGTGCAGGTTTTGGAACTAGGCCTGTGGGAAGG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Height: Genome-wide association study of body height in African Americans: the Women's Health Initiative SNP Health Association Resource (SHARe). (View Study)
- Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: