
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-81a5.5
- Ensembl ID:
- ENSDARG00000036412
- ZFIN ID:
- ZDB-GENE-060503-892
- Description:
- hypothetical protein LOC558774 [Source:RefSeq peptide;Acc:NP_001038339]
- Human Orthologue:
- C1orf92
- Human Description:
- chromosome 1 open reading frame 92 [Source:HGNC Symbol;Acc:26556]
- Mouse Orthologue:
- 4933430H15Rik
- Mouse Description:
- RIKEN cDNA 4933430H15 gene Gene [Source:MGI Symbol;Acc:MGI:1921735]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa45659 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa23446 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa45659
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052898 | Nonsense | 116 | 481 | 4 | 14 |
The following transcripts of ENSDARG00000036412 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 9716678)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 9175217 GRCz11 19 9094142 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAACTGATGCTTCAGGTGCTGAGCAAGATATTGCCGTCTCTCAGTAATT[T/A]ACTGTGCTTGCGGTAAGCTTTTATATTTTGAGTTGTGTGTTGTGTTTGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23446
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052898 | Essential Splice Site | 340 | 481 | None | 14 |
The following transcripts of ENSDARG00000036412 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 9719585)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 9178124 GRCz11 19 9097049 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCACAAAGTCCGGCAGCAAAAAAAGAGGAGGCAAAGGTGGCCAAGAAAGG[T/C]AAATAAACTCCTTTGACATAGTTTATTTGGATTGAAAAACTGATTTTATA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: