si:ch211-81a5.5

Ensembl ID:
ENSDARG00000036412
ZFIN ID:
ZDB-GENE-060503-892
Description:
hypothetical protein LOC558774 [Source:RefSeq peptide;Acc:NP_001038339]
Human Orthologue:
C1orf92
Human Description:
chromosome 1 open reading frame 92 [Source:HGNC Symbol;Acc:26556]
Mouse Orthologue:
4933430H15Rik
Mouse Description:
RIKEN cDNA 4933430H15 gene Gene [Source:MGI Symbol;Acc:MGI:1921735]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45659 Nonsense Mutation detected in F1 DNA During 2018
sa23446 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa45659
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052898 Nonsense 116 481 4 14

The following transcripts of ENSDARG00000036412 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 9716678)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9175217
GRCz11 19 9094142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAACTGATGCTTCAGGTGCTGAGCAAGATATTGCCGTCTCTCAGTAATT[T/A]ACTGTGCTTGCGGTAAGCTTTTATATTTTGAGTTGTGTGTTGTGTTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23446
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052898 Essential Splice Site 340 481 None 14

The following transcripts of ENSDARG00000036412 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 9719585)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9178124
GRCz11 19 9097049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACAAAGTCCGGCAGCAAAAAAAGAGGAGGCAAAGGTGGCCAAGAAAGG[T/C]AAATAAACTCCTTTGACATAGTTTATTTGGATTGAAAAACTGATTTTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link