zgc:112329

Ensembl ID:
ENSDARG00000036338
ZFIN ID:
ZDB-GENE-050731-5
Description:
vacuolar protein sorting-associated protein 11 homolog [Source:RefSeq peptide;Acc:NP_001032797]
Mouse Orthologue:
Vps11
Mouse Description:
vacuolar protein sorting 11 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1918982]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12276 Essential Splice Site Available for shipment Available now
sa6174 Nonsense Mutation detected in F1 DNA During 2018
sa34930 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa12276
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052787 Essential Splice Site 48 927 1 16
Genomic Location (Zv9):
Chromosome 10 (position 30659616)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 29882020
GRCz11 10 29768360
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGGMATATCGGCCTGTGATTCAGGCCGAGGAYACATTGTGCTCGGAGA[T/A]ATCCTTAWAATGCTTGTKGCTAGTTAGCAATGATGATACTGTCAAACAGY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6174
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052787 Nonsense 711 927 13 16
Genomic Location (Zv9):
Chromosome 10 (position 30650488)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 29872892
GRCz11 10 29759232
KASP Assay ID:
554-5273.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCGCTATGGGGACAGCGAAGTGTGCTTGTGGGAGCAGGCACTGGGCTA[T/A]TTCGCACGCAAAGAAGAAAACTGCAAGTCCTACATTAGTGAAGYCYTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34930
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052787 Nonsense 845 927 15 16
Genomic Location (Zv9):
Chromosome 10 (position 30645772)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 29868176
GRCz11 10 29754516
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACACTGCTTAGAGAGCTTCGCTGAGAGTGAGGCAGAGTGTCCCACCTG[C/A]ACCCCTGAGAACAGGAAGGTCATGGACATGTTGCGTGCGCAGGATCAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link