
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gnb1l
- Ensembl ID:
- ENSDARG00000036293
- ZFIN ID:
- ZDB-GENE-050320-77
- Description:
- guanine nucleotide-binding protein subunit beta-like protein 1 [Source:RefSeq peptide;Acc:NP_001013
- Human Orthologue:
- GNB1L
- Human Description:
- guanine nucleotide binding protein (G protein), beta polypeptide 1-like [Source:HGNC Symbol;Acc:4397
- Mouse Orthologue:
- Gnb1l
- Mouse Description:
- guanine nucleotide binding protein (G protein), beta polypeptide 1-like Gene [Source:MGI Symbol;Acc:
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa1418 | Nonsense | Available for shipment | Available now |
sa20363 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa1418
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052712 | Nonsense | 57 | 323 | 3 | 7 |
The following transcripts of ENSDARG00000036293 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 5 (position 16967211)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 14763079 GRCz11 5 15263296 - KASP Assay ID:
- 554-1339.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGGTGCRGTCCATGYGTGGAACCTGAGCACCAGGAGAGCAGAACGTGTTT[T/A]AGAGAGCCATGCTGGGAACTCTGTAATCTGGCTTAACACCTTCAACAACA
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa20363
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052712 | Nonsense | 176 | 323 | 6 | 7 |
The following transcripts of ENSDARG00000036293 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 5 (position 16939106)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 14734974 GRCz11 5 15235191 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCGTTTCTTTCTCCTCAGGCTGATTCTGGTCCAGTTCTATGTGCCGGTTA[T/A]GAGGATGGCTCGGTGGTATTATGGGATGTTTCTCATCGCCGTCCATTCAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: