
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
hnrnpa0l
- Ensembl ID:
- ENSDARG00000036161
- ZFIN ID:
- ZDB-GENE-030131-618
- Description:
- Hnrpa0l protein [Source:UniProtKB/TrEMBL;Acc:Q7ZU48]
- Human Orthologue:
- HNRNPA0
- Human Description:
- heterogeneous nuclear ribonucleoprotein A0 [Source:HGNC Symbol;Acc:5030]
- Mouse Orthologue:
- Hnrnpa0
- Mouse Description:
- heterogeneous nuclear ribonucleoprotein A0 Gene [Source:MGI Symbol;Acc:MGI:1924384]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa18044 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa18044
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052511 | Nonsense | 124 | 302 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 14 (position 40346381)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 38509615 GRCz11 14 38849929 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACATCGAGGACGAACACCTTCAAGATTATTTCTCACAGTTTGGGCCCATC[G/T]ARAAGGCGCAGGTCATMACCGACAAAGACACCGGGAAGAAGCGAGGCTTC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: