zgc:153225

Ensembl ID:
ENSDARG00000036144
ZFIN ID:
ZDB-GENE-060825-263
Description:
Protein TSSC4 [Source:UniProtKB/Swiss-Prot;Acc:Q0P4A6]
Human Orthologue:
TSSC4
Human Description:
tumor suppressing subtransferable candidate 4 [Source:HGNC Symbol;Acc:12386]
Mouse Orthologue:
Tssc4
Mouse Description:
tumor-suppressing subchromosomal transferable fragment 4 Gene [Source:MGI Symbol;Acc:MGI:1861712]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40935 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40935
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075263   None 306 None 4
ENSDART00000132020 Essential Splice Site None 213 1 2
ENSDART00000133584   None 248 None 4
ENSDART00000135237   None 242 None 4
ENSDART00000137956   None 229 None 4
ENSDART00000140775   None 234 None 4
ENSDART00000140800   None 127 None 3
ENSDART00000142049   None 188 None 4
ENSDART00000145523   None 205 None 4
ENSDART00000146789   None 199 None 4
Genomic Location (Zv9):
Chromosome 7 (position 34232858)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32627198
GRCz11 7 32898348
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTATTTTACTGAATGTGAAAGTATCTCCCCAATGTGTGAGTTAAGCAAG[G/A]TGAGTTATGATCAGTAGTTGTCTAACTACGGTTTCTATTTCAGGTTCCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link