zgc:136220

Ensembl ID:
ENSDARG00000036140
ZFIN ID:
ZDB-GENE-070410-2
Description:
betagammaX-crystallin [Source:RefSeq peptide;Acc:NP_001028894]
Human Orthologues:
CRYGN, CRYGS
Human Descriptions:
crystallin, gamma N [Source:HGNC Symbol;Acc:20458]
crystallin, gamma S [Source:HGNC Symbol;Acc:2417]
Mouse Orthologues:
Crygn, Crygs
Mouse Descriptions:
crystallin, gamma N Gene [Source:MGI Symbol;Acc:MGI:2449167]
crystallin, gamma S Gene [Source:MGI Symbol;Acc:MGI:1298216]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20995 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20995
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049588 Essential Splice Site 165 208 5 6
Genomic Location (Zv9):
Chromosome 7 (position 35566004)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33951624
GRCz11 7 34222774
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCGTTACAGTCTGAACAGAGTGTCCTCCATGAGAATTGTGGGTGGAAC[G/A]TAAGTACATGTCCACTTGAGTCGAAGAACTTCCTTTTTTTTTTCATTCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link