bbox1

Ensembl ID:
ENSDARG00000036135
ZFIN ID:
ZDB-GENE-050417-218
Description:
gamma-butyrobetaine dioxygenase [Source:RefSeq peptide;Acc:NP_001017717]
Human Orthologue:
BBOX1
Human Description:
butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1 [Source:HGNC S
Mouse Orthologue:
Bbox1
Mouse Description:
butyrobetaine (gamma), 2-oxoglutarate dioxygenase 1 (gamma-butyrobetaine hydroxylase) Gene [Source:M

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45283 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45283
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052471 Essential Splice Site 119 325 2 6
ENSDART00000121805 Essential Splice Site 119 433 1 7
Genomic Location (Zv9):
Chromosome 7 (position 35642468)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34028295
GRCz11 7 34299445
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGGACGTGCACACCGGGATGGATCACGTACAACTGATGGATAATAAG[G/A]TTGGTCTTGGTAAGCTTTATTTTGAAGGGCTCCTATAGACATCCTGTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link