
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000036128
- Ensembl ID:
- ENSDARG00000036128
- Human Orthologues:
- GTF2IRD2, GTF2IRD2B
- Human Descriptions:
- GTF2I repeat domain containing 2 [Source:HGNC Symbol;Acc:30775]
- GTF2I repeat domain containing 2B [Source:HGNC Symbol;Acc:33125]
- Mouse Orthologue:
- Gtf2ird2
- Mouse Description:
- GTF2I repeat domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2149780]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
hu7873 | Nonsense | Available for shipment | Available now |
sa18606 | Essential Splice Site | Available for shipment | Available now |
sa45670 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- hu7873
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052455 | Nonsense | 175 | 400 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 19 (position 24243375)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 24172790 GRCz11 19 23757113 - KASP Assay ID:
- 554-2381.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAGTCAATSCAAAGCTGCAGCTGACCATCTCCGCRTYATGCAAGACAAAT[T/A]ATACGTGTGCAACGTTGTGTTTTNAACAGACATCTTCTCCCATTTAAATA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18606
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052455 | Essential Splice Site | 345 | 400 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 19 (position 24242864)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 24172279 GRCz11 19 23756602 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTTGGGTATCTTGTCCCGAGACCTATGACACATTAAAAAYGCTGGCTAT[G/A]TATGTGCTCACCATGTTCGGTTSAACCTACACCTGNNNTGAGGCTGCATTCTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45670
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000052455 | Nonsense | 355 | 400 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 19 (position 24242812)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 24172227 GRCz11 19 23756550 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGTGCTCACCATGTTCGGTTGAACCTACACCTGTGAGGCTGCATTCTCC[A/T]AGATGAACTCGATAAAAACACACGAGAGGAACCGACTGTCAACCCAGTCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: