ENSDARG00000036128

Ensembl ID:
ENSDARG00000036128
Human Orthologues:
GTF2IRD2, GTF2IRD2B
Human Descriptions:
GTF2I repeat domain containing 2 [Source:HGNC Symbol;Acc:30775]
GTF2I repeat domain containing 2B [Source:HGNC Symbol;Acc:33125]
Mouse Orthologue:
Gtf2ird2
Mouse Description:
GTF2I repeat domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2149780]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu7873 Nonsense Available for shipment Available now
sa18606 Essential Splice Site Available for shipment Available now
sa45670 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
hu7873
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052455 Nonsense 175 400 1 2
Genomic Location (Zv9):
Chromosome 19 (position 24243375)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 24172790
GRCz11 19 23757113
KASP Assay ID:
554-2381.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTCAATSCAAAGCTGCAGCTGACCATCTCCGCRTYATGCAAGACAAAT[T/A]ATACGTGTGCAACGTTGTGTTTTNAACAGACATCTTCTCCCATTTAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18606
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052455 Essential Splice Site 345 400 1 2
Genomic Location (Zv9):
Chromosome 19 (position 24242864)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 24172279
GRCz11 19 23756602
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGGGTATCTTGTCCCGAGACCTATGACACATTAAAAAYGCTGGCTAT[G/A]TATGTGCTCACCATGTTCGGTTSAACCTACACCTGNNNTGAGGCTGCATTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45670
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052455 Nonsense 355 400 2 2
Genomic Location (Zv9):
Chromosome 19 (position 24242812)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 24172227
GRCz11 19 23756550
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGCTCACCATGTTCGGTTGAACCTACACCTGTGAGGCTGCATTCTCC[A/T]AGATGAACTCGATAAAAACACACGAGAGGAACCGACTGTCAACCCAGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link