si:dkeyp-92c9.2

Ensembl ID:
ENSDARG00000036105
ZFIN ID:
ZDB-GENE-060503-468
Description:
hypothetical protein LOC571482 [Source:RefSeq peptide;Acc:NP_001038685]
Human Orthologue:
CDK5R1
Human Description:
cyclin-dependent kinase 5, regulatory subunit 1 (p35) [Source:HGNC Symbol;Acc:1775]
Mouse Orthologue:
Cdk5r1
Mouse Description:
cyclin-dependent kinase 5, regulatory subunit 1 (p35) Gene [Source:MGI Symbol;Acc:MGI:101764]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23527 Nonsense Available for shipment Available now
sa44914 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa23527
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052420 Nonsense 44 317 1 1
Genomic Location (Zv9):
Chromosome 19 (position 25082118)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 25012230
GRCz11 19 24596453
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCGAGCCTGAGCAGCCGCTCTCTGAACACTCAAAAGGACCGCAGCCTC[A/T]AACGCGGCCATTCCATCTTTCTCCCTGCTCTCACCTGGAAACGCCTGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44914
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052420 Nonsense 308 317 1 1
Genomic Location (Zv9):
Chromosome 19 (position 25082911)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 25013023
GRCz11 19 24597246
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTTCACGCAGGTTTTTGCTGATCTAAAGAGTGAAGGAGGTTGCAGTT[T/A]GCAGGACTACGCTAGAGTTTTAGATCGGTGAAAAGAGGAACTGGCAGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link