zgc:77714

Ensembl ID:
ENSDARG00000036102
ZFIN ID:
ZDB-GENE-030131-184
Description:
carboxy-terminal domain RNA polymerase II polypeptide A small phosphatase 2 [Source:RefSeq peptide;
Human Orthologue:
CTDSP2
Human Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 [Source:HGNC Sym
Mouse Orthologue:
Ctdsp2
Mouse Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 Gene [Source:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43984 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43984
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104035 Nonsense 45 258 2 7

The following transcripts of ENSDARG00000036102 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 24964480)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24750600
GRCz11 23 24677141
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGAAACCTGGGAGTCGGAATATCTTCAAAAAGCTCATCTGTTGCCTT[C/T]GAGCTCAAGATGCCCAGCTGCCAACTTCACCTACCCATGATGCCTTGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link