smad3a

Ensembl ID:
ENSDARG00000036096
ZFIN ID:
ZDB-GENE-000509-3
Description:
MAD homolog 3a [Source:RefSeq peptide;Acc:NP_571646]
Human Orthologue:
SMAD3
Human Description:
SMAD family member 3 [Source:HGNC Symbol;Acc:6769]
Mouse Orthologue:
Smad3
Mouse Description:
MAD homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1201674]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34112 Nonsense Mutation detected in F1 DNA During 2018
sa2363 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34112
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045374 Nonsense 195 425 4 9
Genomic Location (Zv9):
Chromosome 7 (position 35465442)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33850176
GRCz11 7 34121326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACGCCACCTCCCGGCTACATCAGTGAGGATGGAGAAACCAGCGATCAT[C/T]AGATGAACCGGAGCATGGACACAGGTGACAGATTGCTTTCTTTGGTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2363
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045374 Nonsense 228 425 6 9
Genomic Location (Zv9):
Chromosome 7 (position 35462349)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 33847083
GRCz11 7 34118233
KASP Assay ID:
554-2875.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCTCTTTTTTNNCTCTCTCTTTTAGATCTMCAGCCAGTGACATACTGT[G/T]AACCAGCATTTTGGTGCTCTATTTCCTACTACGAATTGAACCAGCGAGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link